Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 80 (SNORD80) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 80 (SNORD80) URS000050BD61_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD80: SNORD80 is a small nucleolar RNA (snoRNA) that is involved in guiding the modification of G1612 in the 28S rRNA [PMC5389715]. It interacts with SNORD118 (also known as U8), which is necessary for the maturation of 5.8S and 28S rRNAs [PMC5389715]. SNORD80 and other snoRNAs, including SNORD44, SNORD47, SNORD76, SNORD78, SNORD79, SNORD81, SNORD74, SNORD75, and SNORD77, are located within the Small Nucleolar RNA Host Gene 2 (SNHG2) or Growth Arrest Specific 5 (GAS5) [PMC9598326]. These snoRNAs are involved in pre-rRNA processing and are represented among nucleolar reads [PMC4159348]. In various conditions such as UC and LDHB deficiency or MES/EMT transition in cancer cells, deregulation of genes including CACNA2D1, GNG2, SLC15A2 along with genes such as HDGFRP3 and PRHOXNB have been observed along with deregulation of snoRNAs like snorD79 and snorD47 [PMC4450908] [PMC6965107]. In mice as well as humans GAS5 contains snoRNAs like snorD47 snorD78 and snorD80 interspersed within its introns [PMC6789762] . Mutations in both alleles of genes like snorD74 ,snorD77 ,snorD80 have been observed to affect their secondary structure formation ability. These mutations have been observed to affect their expression levels too. CRISPR/Cas9 cleavage of these snoRNAs has also resulted in impairment of their structure formation ability. The interaction between SNORD80 and FMRP has been observed and confirmed through experiments [PMC6249352]. SNORD80 has been found to bind to specific sites in 28S rRNA [PMC7812872]. The GAS5-encoded snoRNAs, including SNORD80, are predicted to regulate rRNA methylation and pseudouridylation [PMC8658237] [PMC9219770].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAAUGAUGAUAACAUAGUUCAGCAGACUAACGCUGAUGAGCAAUAUUAAGUCUUUCGCUCCUAUCUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications