Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p URS000050B527_246437

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tupaia chinensis. Annotated by 2 databases (RefSeq, miRBase). Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p sequence is a product of tch-miR-146a, MIR146A, miR-146a, miR-146, miR-146a-5p, tch-miR-146a-5p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGAACUGAAUUCCAUGGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-146-P4_5p (mature (guide))
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-146a
    3. Canis lupus familiaris (dog) cfa-miR-146a
    4. Cervus elaphus cel-miR-146a
    5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
    6. Equus caballus eca-miR-146a
    7. Gallus gallus gga-miR-146a-5p
    8. Homo sapiens hsa-miR-146a-5p
    9. Macaca mulatta mml-miR-146a-5p
    10. Microcebus murinus (gray mouse lemur) mmr-miR-146a
    11. Monodelphis domestica mdo-miR-146a-5p
    12. Mus musculus (house mouse) mmu-miR-146a-5p
    13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-146a
    14. Pan troglodytes (chimpanzee) ptr-miR-146a
    15. Papio hamadryas pha-miR-146a
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-146a
    17. Pteropus alecto (black flying fox) pal-miR-146a-5p
    18. Rattus norvegicus (Norway rat) rno-miR-146a-5p
    19. Sus scrofa ssc-miR-146a-5p
    20. Taeniopygia guttata tgu-miR-146c
    Publications