Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 32A (SNORD32A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 32A (SNORD32A) URS000050B350_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD32A: SNORD32A is a box C/D snoRNA that is located in the introns of RPL13A, a component of the 60s ribosomal subunit protein [PMC4436665]. In response to exposure to pro-inflammatory saturated fatty acids, such as palmitate, stearate, or myristate, the expression of four snoRNAs, including SNORD32A, is increased [PMC8142323]. These snoRNAs are known to introduce 2’-O-Methylations in target RNAs [PMC8142323]. The increased expression of these snoRNAs in response to exposure to pro-inflammatory saturated fatty acids suggests their involvement in cellular responses to inflammation [PMC8142323]. The specific role of SNORD32A in this process is not mentioned in the given context. However, as a box C/D snoRNA, it is likely involved in guiding 2’-O-Methylations on target RNAs [PMC4436665]. Further research may be needed to fully understand the function and significance of SNORD32A and other snoRNAs in response to pro-inflammatory saturated fatty acids [PMC8142323].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUCAGUGAUGAGCAACAUUCACCAUCUUUCGUUUGAGUCUCACGGCCAUGAGAUCAACCCCAUGCACCGCUCUGAGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications