Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lolium arundinaceum far-miR156a URS0000509E19_4606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Lolium arundinaceum. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACAGAAGAGAGAGAGCACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Ananas comosus (pineapple) microRNA 156d
    2. Brachypodium distachyon (stiff brome) bdi-miR156a
    3. Cynara cardunculus var. scolymus cca-miR156j
    4. Glycine max gma-miR156b
    5. Medicago truncatula (barrel medic) mtr-miR156a
    6. Oryza sativa Japonica Group microRNA osa-miR156k
    7. Oryza sativa osa-miR156k
    8. Ricinus communis (castor bean) rco-miR156e
    9. Sorghum bicolor (sorghum) sbi-miR156d
    10. Theobroma cacao (cacao) tcc-miR156a
    11. Zea mays zma-miR156j-5p