Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sorghum bicolor (sorghum) sbi-miR156d URS0000509E19_4558

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Sorghum bicolor. Annotated by 2 databases (miRBase, ENA). Described in 1 paper. Sorghum bicolor (sorghum) sbi-miR156d sequence is a product of sbi-miR156d, miR156d, miR156 genes. Found in the sorghum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACAGAAGAGAGAGAGCACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Ananas comosus (pineapple) microRNA 156d
    2. Brachypodium distachyon bdi-miR156a
    3. Cynara cardunculus var. scolymus cca-miR156j
    4. Glycine max gma-miR156b
    5. Lolium arundinaceum far-miR156a
    6. Medicago truncatula mtr-miR156a
    7. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156k
    8. Oryza sativa osa-miR156k
    9. Ricinus communis (castor bean) rco-miR156e
    10. Theobroma cacao tcc-miR156a
    11. Zea mays zma-miR156j-5p