Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Zalophus californianus (california sea lion) miRNA secondary structure diagram

Zalophus californianus (california sea lion) miRNA URS0000507C9B_9704

Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Zalophus californianus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-17, RF00051). Found in the california sea lion reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 20a (MIR20A)
    2. Aotus nancymaae miRNA
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-20 precursor
    4. Bos taurus (cattle) microRNA bta-mir-20a precursor
    5. Capra hircus (Goat) microRNA mir-20a (MIR20A)
    6. Cercocebus atys (Sooty mangabey) miRNA
    7. Chlorocebus sabaeus (African green monkey) miRNA
    8. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA
    9. Colobus angolensis palliatus miRNA
    10. Equus caballus (horse) microRNA eca-mir-20a precursor
    11. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-20a
    12. Gorilla gorilla microRNA ggo-mir-20a precursor
    13. Homo sapiens microRNA hsa-mir-20a precursor
    14. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-20 precursor
    15. Macaca fascicularis (Crab-eating macaque) miRNA
    16. Macaca mulatta microRNA mml-mir-20a precursor
    17. Macaca nemestrina microRNA mne-mir-20 precursor
    18. Mandrillus leucophaeus (Drill) miRNA
    19. Marmota marmota marmota microRNA 20a
    20. Mustela putorius furo (Domestic ferret) miRNA
    21. Myotis lucifugus miRNA
    22. Neovison vison miRNA
    23. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    24. Ovis aries miRNA
    25. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-20 precursor
    26. Panthera pardus microRNA 20a
    27. Panthera tigris altaica (Tiger) miRNA
    28. Pan troglodytes (chimpanzee) microRNA ptr-mir-20a precursor
    29. Papio anubis (Olive baboon) miRNA
    30. Pongo abelii microRNA 20a
    31. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-20a precursor
    32. Pteropus vampyrus miRNA
    33. Rhinopithecus bieti miRNA
    34. Rhinopithecus roxellana miRNA
    35. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-20 precursor
    36. Saimiri boliviensis boliviensis miRNA
    37. Spermophilus dauricus miRNA
    38. Sus scrofa (pig) microRNA ssc-mir-20a precursor
    39. Tupaia belangeri miRNA
    40. Tursiops truncatus (bottlenosed dolphin) miRNA
    41. Urocitellus parryii miRNA
    42. Ursus americanus (American black bear) miRNA
    43. Ursus maritimus (Polar bear) miRNA
    44. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 20a
    2D structure New