Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ailuropoda melanoleuca (giant panda) microRNA 20a (ENSAMEG00000023283.2) secondary structure diagram

Ailuropoda melanoleuca (giant panda) microRNA 20a (ENSAMEG00000023283.2) URS0000507C9B_9646

Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Ailuropoda melanoleuca. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-17, RF00051). Ailuropoda melanoleuca (giant panda) microRNA 20a (ENSAMEG00000023283.2) sequence is a product of ENSAMEG00000023283.2 gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 79 other species

    1. Aotus nancymaae miRNA (ENSANAG00000015021.1)
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-20 precursor
    3. Bos taurus (cattle) microRNA bta-mir-20a precursor
    4. Capra hircus microRNA mir-20a (ENSCHIG00000009259.1)
    5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000020027.1)
    6. Chlorocebus sabaeus miRNA (ENSCSAG00000025440.1)
    7. Choloepus hoffmanni miRNA (ENSCHOG00000014344.1)
    8. Colobus angolensis palliatus miRNA (ENSCANG00000009318.1)
    9. Equus caballus microRNA eca-mir-20a precursor
    10. Gorilla gorilla gorilla ggo-mir-20a (ENSGGOG00000032749.2)
    11. Gorilla gorilla (western gorilla) microRNA ggo-mir-20a precursor
    12. Homo sapiens (human) microRNA hsa-mir-20a precursor
    13. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-20 precursor
    14. Macaca fascicularis (Crab-eating macaque) miRNA
    15. Macaca mulatta microRNA mml-mir-20a precursor
    16. Macaca nemestrina microRNA mne-mir-20 precursor
    17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000015033.1)
    18. Marmota marmota marmota (Alpine marmot) microRNA 20a (ENSMMMG00000021343.1)
    19. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023481.1)
    20. Myotis lucifugus miRNA (ENSMLUG00000017816.1)
    21. Neovison vison miRNA (ENSNVIG00000016027.1)
    22. Nomascus leucogenys miRNA (ENSNLEG00000019456.2)
    23. Ovis aries (sheep) miRNA (ENSOARG00000025155.1)
    24. Pan paniscus microRNA ppa-mir-20 precursor
    25. Panthera pardus microRNA 20a (ENSPPRG00000014295.1)
    26. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002079.1)
    27. Pan troglodytes (chimpanzee) microRNA ptr-mir-20a precursor
    28. Papio anubis miRNA (ENSPANG00000019115.2)
    29. Pongo abelii microRNA 20a (ENSPPYG00000021917.1)
    30. Pongo pygmaeus microRNA ppy-mir-20a precursor
    31. Pteropus vampyrus miRNA (ENSPVAG00000024896.1)
    32. Rhinopithecus bieti miRNA (ENSRBIG00000009738.1)
    33. Rhinopithecus roxellana miRNA (ENSRROG00000003835.1)
    34. Saguinus labiatus microRNA sla-mir-20 precursor
    35. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000009772.1)
    36. Spermophilus dauricus miRNA (ENSSDAG00000003442.1)
    37. Sus scrofa microRNA ssc-mir-20a precursor
    38. Tupaia belangeri miRNA (ENSTBEG00000017955.1)
    39. Tursiops truncatus miRNA (ENSTTRG00000022154.1)
    40. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010007917.1)
    41. Ursus americanus miRNA (ENSUAMG00000023255.1)
    42. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000025288.1)
    43. Ursus thibetanus thibetanus microRNA 20a (ENSUTTG00000000117.1)
    44. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015012883.1)
    2D structure New