Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Aotus nancymaae (Ma's night monkey) miRNA secondary structure diagram

Aotus nancymaae (Ma's night monkey) miRNA URS0000507C9B_37293

Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Aotus nancymaae. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-17, RF00051). Found in the ma's night monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 20a (MIR20A)
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-20 precursor
    3. Bos taurus (cattle) microRNA bta-mir-20a precursor
    4. Capra hircus (Goat) microRNA mir-20a (MIR20A)
    5. Cercocebus atys (Sooty mangabey) miRNA
    6. Chlorocebus sabaeus (African green monkey) miRNA
    7. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA
    8. Colobus angolensis palliatus miRNA
    9. Equus caballus (horse) microRNA eca-mir-20a precursor
    10. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-20a
    11. Gorilla gorilla microRNA ggo-mir-20a precursor
    12. Homo sapiens microRNA hsa-mir-20a precursor
    13. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-20 precursor
    14. Macaca fascicularis (Crab-eating macaque) miRNA
    15. Macaca mulatta microRNA mml-mir-20a precursor
    16. Macaca nemestrina microRNA mne-mir-20 precursor
    17. Mandrillus leucophaeus (Drill) miRNA
    18. Marmota marmota marmota microRNA 20a
    19. Mustela putorius furo (Domestic ferret) miRNA
    20. Myotis lucifugus miRNA
    21. Neovison vison miRNA
    22. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    23. Ovis aries miRNA
    24. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-20 precursor
    25. Panthera pardus microRNA 20a
    26. Panthera tigris altaica (Tiger) miRNA
    27. Pan troglodytes (chimpanzee) microRNA ptr-mir-20a precursor
    28. Papio anubis (Olive baboon) miRNA
    29. Pongo abelii microRNA 20a
    30. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-20a precursor
    31. Pteropus vampyrus miRNA
    32. Rhinopithecus bieti miRNA
    33. Rhinopithecus roxellana miRNA
    34. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-20 precursor
    35. Saimiri boliviensis boliviensis miRNA
    36. Spermophilus dauricus miRNA
    37. Sus scrofa (pig) microRNA ssc-mir-20a precursor
    38. Tupaia belangeri miRNA
    39. Tursiops truncatus (bottlenosed dolphin) miRNA
    40. Urocitellus parryii miRNA
    41. Ursus americanus (American black bear) miRNA
    42. Ursus maritimus (Polar bear) miRNA
    43. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 20a
    44. Zalophus californianus miRNA
    2D structure New