Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-23a-5p URS00005070A9_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-23a: Rno-mir-23a is a microRNA that has been used as a housekeeping control in various studies [PMC7226994] [PMC5838212] [PMC3184440]. It has been shown to be suitable for normalizing miRNA content in astrocyte-derived small extracellular vesicles (sEVs) in response to ATP, TNFα, or IL-1β stimuli [PMC7226994]. Additionally, rno-mir-23a has been used as a housekeeping control for microRNA analysis of astrocyte-derived extracellular vesicles (ADEVs) as its expression remained unchanged with different stimuli [PMC5838212]. Rno-mir-23a is among the abundantly expressed miRNAs in ZO cardiac tissue [PMC3184440]. It has also been included in the target miRNAs for assessment using the TaqMan MicroRNA assay, along with other miRNAs such as rno-miR-26a and rno-miR-101b [PMC4113183].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGUUCCUGGGGAUGGGAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-23a-5p
  2. Cervus elaphus cel-miR-23a-5p
  3. Cricetulus griseus cgr-miR-23a-5p
  4. Dasypus novemcinctus dno-miR-23a-5p
  5. Homo sapiens (human) hsa-miR-23a-5p
  6. Mus musculus mmu-miR-23a-5p
Publications