Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4705 URS00004FE139_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4705: Hsa-mir-4705 is a microRNA that has been implicated in the regulation of gastric cancer progression [PMC8798177]. The abnormal expression of hsa-mir-4705, along with other molecules such as hsa_circ_0067934 and BMPR1B, can disrupt the signaling pathways involved in stem cell pluripotency and the Hippo pathway, leading to the development and progression of gastric cancer [PMC8798177]. However, further experiments are needed to fully understand the role of hsa-mir-4705 in gastric cancer [PMC8798177]. In a study, hsa_circ_0067934 was knocked down in normal gastric cell lines to investigate its impact on the expression of hsa-mir-4705 and BMPR1B [PMC8798177]. BMPR1B is a transmembrane receptor that is targeted by hsa-mir-4705 and belongs to the bone morphogenetic protein receptor family [PMC8798177]. Hsa-mir-4705 was initially discovered in breast cancer through next-generation sequencing [PMC8798177]. The dysregulation of hsa-mir-4705 has been found to suppress the expression of BMPR1B in gastric cancer, suggesting its role as a tumor suppressor [PMC8798177]. Additionally, several miRNAs have been identified as common targets shared by different modules or networks involving hsa-mir-4705, such as miR-421, miR-1299, miR-3167, miR-148a-5p, miR106b-5p, miR20a-5p, and miR34a3p [PMC9441041] [PMC9650411] [PMC6557814].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAUCACUUGGUAAUUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications