Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila yakuba dya-miR-263b URS00004FD7F0_7245

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila yakuba. Annotated by 2 databases (Ensembl Metazoa, miRBase). Described in 1 paper. Drosophila yakuba dya-miR-263b sequence is a product of FBtr0298787_df_nrg, FBtr0298775_df_nrg genes. Found in the Drosophila yakuba reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUGGCACUGGGAGAAUUCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Anopheles gambiae (African malaria mosquito) aga-miR-263b
    2. Bombyx mori bmo-miR-263b-5p
    3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-263b
    4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-263b
    5. Drosophila ananassae dan-miR-263b
    6. Drosophila erecta der-miR-263b
    7. Drosophila grimshawi dgr-miR-263b
    8. Drosophila melanogaster dme-miR-263b-5p
    9. Drosophila persimilis dpe-miR-263b
    10. Drosophila pseudoobscura dps-miR-263b
    11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294503_df_nrg
    12. Drosophila sechellia dse-miR-263b
    13. Drosophila simulans dsi-miR-263b
    14. Drosophila willistoni dwi-miR-263b