Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (pig-tailed macaque) mne-miR-29a URS00004FB43D_9545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAGCACCAUCUGAAAUCGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Ateles geoffroyi (black-handed spider monkey) age-miR-29a
  2. Gorilla gorilla gorilla ggo-miR-29a (MIR29A)
  3. Gorilla gorilla (western gorilla) ggo-miR-29a
  4. Homo sapiens (human) miscellaneous RNA
  5. Lagothrix lagotricha (brown woolly monkey) lla-miR-29a
  6. Macaca mulatta (Rhesus monkey) mml-miR-29a-3p
  7. Mus musculus Mus_musculus piRNA piR-mmu-8118314
  8. Pan paniscus ppa-miR-29a
  9. Pan troglodytes ptr-miR-29a
  10. Pongo pygmaeus ppy-miR-29a
  11. Saguinus labiatus (red-chested mustached tamarin) sla-miR-29a
  12. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-29a