Macaca mulatta (Rhesus monkey) mml-miR-29a-3p URS00004FB43D_9544

• 22 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 12 other species
• 5266 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CUAGCACCAUCUGAAAUCGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Ateles geoffroyi (black-handed spider monkey) age-miR-29a
2. Gorilla gorilla gorilla ggo-miR-29a (MIR29A)
3. Gorilla gorilla (western gorilla) ggo-miR-29a
4. Homo sapiens (human) miscellaneous RNA
5. Lagothrix lagotricha (brown woolly monkey) lla-miR-29a
6. Macaca nemestrina (pig-tailed macaque) mne-miR-29a
7. Mus musculus Mus_musculus piRNA piR-mmu-8118314
8. Pan paniscus ppa-miR-29a
9. Pan troglodytes ptr-miR-29a
10. Pongo pygmaeus ppy-miR-29a
11. Saguinus labiatus (red-chested mustached tamarin) sla-miR-29a
12. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-29a

Publications Download

• FASTA
• JSON