Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) gmo-miR-25-3p URS00004F9744_8049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUGCACUUGUCUCGGUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-25
  2. Bos taurus bta-miR-25
  3. Callithrix jacchus cja-miR-25
  4. Canis lupus familiaris (dog) cfa-miR-25
  5. Capra hircus chi-miR-25-3p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-25-3p
  7. Cervus elaphus (red deer) cel-miR-25
  8. Cricetulus griseus (Chinese hamster) cgr-miR-25-3p
  9. Cyprinus carpio ccr-miR-25
  10. Danio rerio dre-miR-25-3p
  11. Dasypus novemcinctus dno-miR-25-3p
  12. Daubentonia madagascariensis dma-miR-25
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P2d_3p (mature (guide))
  14. Equus caballus eca-miR-25
  15. Gorilla gorilla gorilla ggo-miR-25 (MIR25)
  16. Gorilla gorilla (western gorilla) ggo-miR-25
  17. Haplochromis burtoni abu-miR-25
  18. Homo sapiens (human) hsa-miR-25-3p
  19. Ictalurus punctatus ipu-miR-25
  20. Lagothrix lagotricha (brown woolly monkey) lla-miR-25
  21. Latimeria chalumnae (coelacanth) Lch-Mir-92-P2d_3p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-92-P2d_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-25
  24. Macaca nemestrina (pig-tailed macaque) mne-miR-25
  25. Maylandia zebra (zebra mbuna) mze-miR-25
  26. Monodelphis domestica mdo-miR-25
  27. Monopterus albus Mal-Mir-92-P2d_3p (mature (guide))
  28. Mus musculus mmu-miR-25-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-25
  30. Nomascus leucogenys nle-miR-25
  31. Oreochromis niloticus (Nile tilapia) oni-miR-25
  32. Oryctolagus cuniculus ocu-miR-25-3p
  33. Otolemur garnettii (small-eared galago) oga-miR-25
  34. Ovis aries microRNA miR-25
  35. Pan paniscus ppa-miR-25
  36. Pan troglodytes microRNA mir-25
  37. Papio hamadryas (hamadryas baboon) pha-miR-25
  38. Pongo pygmaeus ppy-miR-25
  39. Pteropus alecto (black flying fox) pal-miR-25-3p
  40. Pundamilia nyererei pny-miR-25
  41. Rattus norvegicus rno-miR-25-3p
  42. Salmo salar (Atlantic salmon) ssa-miR-25-3p
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-92-P2d_3p (mature (guide))
  44. Sus scrofa ssc-mir58
  45. Takifugu rubripes fru-miR-25
  46. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-25
  47. Tor tambroides miR-25-3p
  48. Tupaia chinensis (Chinese tree shrew) tch-miR-25-3p
  49. Xenopus laevis (African clawed frog) xla-miR-25-3p
  50. Xenopus tropicalis xtr-miR-25