Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-25 URS00004F9744_9615

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Canis lupus familiaris. Annotated by 3 databases (RefSeq, miRBase, MirGeneDB). Described in 4 papers. Canis lupus familiaris (dog) cfa-miR-25 sequence is a product of MIR25, miR-25, cfa-miR-25 genes. Found in the dog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUUGCACUUGUCUCGGUCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-25
    2. Bos taurus (cattle) bta-miR-25
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-25
    4. Capra hircus chi-miR-25-3p
    5. Cavia porcellus cpo-miR-25-3p
    6. Cervus elaphus (red deer) cel-miR-25
    7. Cricetulus griseus (Chinese hamster) cgr-miR-25-3p
    8. Cyprinus carpio (common carp) ccr-miR-25
    9. Danio rerio dre-miR-25-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-25-3p
    11. Daubentonia madagascariensis dma-miR-25
    12. Echinops telfairi Ete-Mir-92-P2c_3p (mature (guide))
    13. Equus caballus eca-miR-25
    14. Gadus morhua (Atlantic cod) gmo-miR-25-3p
    15. Gorilla gorilla (western gorilla) ggo-miR-25
    16. Haplochromis burtoni abu-miR-25
    17. Homo sapiens (human) hsa-miR-25-3p
    18. Ictalurus punctatus ipu-miR-25
    19. Lagothrix lagotricha (brown woolly monkey) lla-miR-25
    20. Macaca mulatta mml-miR-25
    21. Macaca nemestrina mne-miR-25
    22. Maylandia zebra (zebra mbuna) mze-miR-25
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-25
    24. Mus musculus mmu-miR-25-3p
    25. Neolamprologus brichardi nbr-miR-25
    26. Nomascus leucogenys nle-miR-25
    27. Oreochromis niloticus (Nile tilapia) oni-miR-25
    28. Oryctolagus cuniculus ocu-miR-25-3p
    29. Otolemur garnettii oga-miR-25
    30. Ovis aries (sheep) microRNA miR-25
    31. Pan paniscus ppa-miR-25
    32. Pan troglodytes (chimpanzee) microRNA mir-25
    33. Papio hamadryas pha-miR-25
    34. Pongo pygmaeus ppy-miR-25
    35. Pteropus alecto (black flying fox) pal-miR-25-3p
    36. Pundamilia nyererei pny-miR-25
    37. Rattus norvegicus rno-miR-25-3p
    38. Salmo salar ssa-miR-25-3p
    39. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-92-P2c_3p (mature (guide))
    40. Sus scrofa ssc-mir58
    41. Takifugu rubripes fru-miR-25
    42. Tetraodon nigroviridis tni-miR-25
    43. Tor tambroides miR-25-3p
    44. Tupaia chinensis (Chinese tree shrew) tch-miR-25-3p
    45. Xenopus laevis xla-miR-25-3p
    46. Xenopus tropicalis xtr-miR-25