Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-25-3p URS00004F9744_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Described in 21 papers. Danio rerio (zebrafish) dre-miR-25-3p sequence is a product of miR-25-3p, dre-miR-25-3p, mir25, dre-miR-25, miR-25 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUUGCACUUGUCUCGGUCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-25
    2. Bos taurus (cattle) bta-miR-25
    3. Callithrix jacchus cja-miR-25
    4. Canis lupus familiaris (dog) cfa-miR-25
    5. Capra hircus (goat) chi-miR-25-3p
    6. Cavia porcellus cpo-miR-25-3p
    7. Cervus elaphus (red deer) cel-miR-25
    8. Cricetulus griseus (Chinese hamster) cgr-miR-25-3p
    9. Cyprinus carpio ccr-miR-25
    10. Dasypus novemcinctus dno-miR-25-3p
    11. Daubentonia madagascariensis dma-miR-25
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P2c_3p (mature (guide))
    13. Equus caballus (horse) eca-miR-25
    14. Gadus morhua gmo-miR-25-3p
    15. Gorilla gorilla ggo-miR-25
    16. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-25
    17. Homo sapiens (human) hsa-miR-25-3p
    18. Ictalurus punctatus ipu-miR-25
    19. Lagothrix lagotricha (brown woolly monkey) lla-miR-25
    20. Macaca mulatta mml-miR-25
    21. Macaca nemestrina mne-miR-25
    22. Maylandia zebra mze-miR-25
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-25
    24. Mus musculus mmu-miR-25-3p
    25. Neolamprologus brichardi nbr-miR-25
    26. Nomascus leucogenys nle-miR-25
    27. Oreochromis niloticus (Nile tilapia) oni-miR-25
    28. Oryctolagus cuniculus (rabbit) ocu-miR-25-3p
    29. Otolemur garnettii (small-eared galago) oga-miR-25
    30. Ovis aries microRNA miR-25
    31. Pan paniscus ppa-miR-25
    32. Pan troglodytes (chimpanzee) microRNA mir-25
    33. Papio hamadryas (hamadryas baboon) pha-miR-25
    34. Pongo pygmaeus ppy-miR-25
    35. Pteropus alecto pal-miR-25-3p
    36. Pundamilia nyererei pny-miR-25
    37. Rattus norvegicus (Norway rat) rno-miR-25-3p
    38. Salmo salar ssa-miR-25-3p
    39. Sarcophilus harrisii Sha-Mir-92-P2c_3p (mature (guide))
    40. Sus scrofa (pig) ssc-mir58
    41. Takifugu rubripes (torafugu) fru-miR-25
    42. Tetraodon nigroviridis tni-miR-25
    43. Tor tambroides (Thai mahseer) miR-25-3p
    44. Tupaia chinensis (Chinese tree shrew) tch-miR-25-3p
    45. Xenopus laevis (African clawed frog) xla-miR-25-3p
    46. Xenopus tropicalis xtr-miR-25