v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-25-3p URS00004F9744_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, miRBase, MirGeneDB, TarBase, ENA, RefSeq, LncBase). Mus musculus (house mouse) mmu-miR-25-3p sequence is a product of Mir25, miR-25, miR-25-3p, mmu-miR-25, mmu-miR-25-3p genes. Found in the Mus musculus reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610030A03Rik, 0610038M03Rik, 0710001G09Rik, 107kDa, 11, 14.7kDa, 1110001A17Rik, 1110001J02Rik, 1110001N06Rik, 1110001P04Rik, 1110002G11Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-25-3p interacts with:

Interaction id Participant Synonyms
URS00004F9744_10090-0 Q61039 Q61039
URS00004F9744_10090-1 Q61039 Q61039

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CAUUGCACUUGUCUCGGUCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 49 other species

    1. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-25
    2. Bos taurus bta-miR-25
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-25
    4. Canis lupus familiaris (dog) cfa-miR-25
    5. Capra hircus (goat) chi-miR-25-3p
    6. Cavia porcellus (domestic guinea pig) cpo-miR-25-3p
    7. Cervus elaphus cel-miR-25
    8. Cricetulus griseus (Chinese hamster) cgr-miR-25-3p
    9. Cyprinus carpio ccr-miR-25
    10. Danio rerio dre-miR-25-3p
    11. Dasypus novemcinctus dno-miR-25-3p
    12. Daubentonia madagascariensis (aye-aye) dma-miR-25
    13. Echinops telfairi Ete-Mir-92-P2d_3p (mature (guide))
    14. Equus caballus eca-miR-25
    15. Gadus morhua gmo-miR-25-3p
    16. Gorilla gorilla (western gorilla) ggo-miR-25
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-25
    18. Homo sapiens hsa-miR-25-3p
    19. Ictalurus punctatus ipu-miR-25
    20. Lagothrix lagotricha (brown woolly monkey) lla-miR-25
    21. Latimeria chalumnae Lch-Mir-92-P2d_3p (mature (guide))
    22. Lepisosteus oculatus Loc-Mir-92-P2d_3p (mature (guide))
    23. Macaca mulatta mml-miR-25
    24. Macaca nemestrina (pig-tailed macaque) mne-miR-25
    25. Maylandia zebra (zebra mbuna) mze-miR-25
    26. Monodelphis domestica mdo-miR-25
    27. Monopterus albus Mal-Mir-92-P2d_3p (mature (guide))
    28. Neolamprologus brichardi nbr-miR-25
    29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-25
    30. Oreochromis niloticus oni-miR-25
    31. Oryctolagus cuniculus ocu-miR-25-3p
    32. Otolemur garnettii oga-miR-25
    33. Ovis aries microRNA miR-25
    34. Pan paniscus ppa-miR-25
    35. Pan troglodytes (chimpanzee) microRNA mir-25
    36. Papio hamadryas pha-miR-25
    37. Pongo pygmaeus (Bornean orangutan) ppy-miR-25
    38. Pteropus alecto (black flying fox) pal-miR-25-3p
    39. Pundamilia nyererei pny-miR-25
    40. Rattus norvegicus (Norway rat) rno-miR-25-3p
    41. Salmo salar ssa-miR-25-3p
    42. Sarcophilus harrisii Sha-Mir-92-P2d_3p (mature (guide))
    43. Sus scrofa ssc-mir58
    44. Takifugu rubripes fru-miR-25
    45. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-25
    46. Tor tambroides miR-25-3p
    47. Tupaia chinensis tch-miR-25-3p
    48. Xenopus laevis (African clawed frog) xla-miR-25-3p
    49. Xenopus tropicalis (tropical clawed frog) xtr-miR-25
     Publications