Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-542-3p URS00004F859B_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, GeneCards, LncBase, MalaCards, TarBase, IntAct, ENA, RefSeq, miRBase). Described in 52 papers. Homo sapiens (human) hsa-miR-542-3p sequence is a product of hsa-miR-542, hsa-miR-542-3p, miR-542-3p, MIR542, miR-542 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 3D3, AAAT, ABHD2, ABL2, ABLL, ABP-280, ABT1, ACAC, ACACA.

Interactions 6

According to IntAct, Homo sapiens (human) hsa-miR-542-3p interacts with:

Interaction id Participant Synonyms
EBI-25815192 intact:EBI-25773021 EBI-25773021 ENST00000521381 mrna_pik3r1
EBI-25815249 intact:EBI-25773021 EBI-25773021 ENST00000521381 mrna_pik3r1
EBI-25814970 intact:EBI-25814973 EBI-25814973 ENST00000554581 mrna_akt1
EBI-25815181 intact:EBI-25814973 EBI-25814973 ENST00000554581 mrna_akt1
EBI-25815203 intact:EBI-25815218 EBI-25815218 ENST00000396751 mrna_ilk
EBI-25815239 intact:EBI-25815218 EBI-25815218 ENST00000396751 mrna_ilk

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGACAGAUUGAUAACUGAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Bos taurus (cattle) Bta-Mir-542_3p (mature (guide))
    2. Canis lupus familiaris (dog) cfa-miR-542
    3. Cavia porcellus cpo-miR-542-3p
    4. Cervus elaphus (red deer) cel-miR-542-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-542-3p
    6. Equus caballus eca-miR-542-3p
    7. Gorilla gorilla (western gorilla) ggo-miR-542
    8. Macaca mulatta mml-miR-542-3p
    9. Microcebus murinus (gray mouse lemur) mmr-miR-542
    10. Mus musculus mmu-miR-542-3p
    11. Nomascus leucogenys nle-miR-542
    12. Oryctolagus cuniculus ocu-miR-542-3p
    13. Pongo pygmaeus ppy-miR-542-3p
    14. Pteropus alecto (black flying fox) pal-miR-542-3p
    15. Rattus norvegicus rno-miR-542-3p
    16. Sus scrofa ssc-miR-542-3p
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-542-3p