Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-454 URS00004F77ED_9598

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Pan troglodytes. Annotated by 2 databases (RefSeq, miRBase). Pan troglodytes (chimpanzee) ptr-miR-454 sequence is a product of MIR454, miR-454, ptr-miR-454 genes. Found in the Pan troglodytes reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGUGCAAUAUUGCUUAUAGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Anolis carolinensis aca-miR-454-3p
    2. Bos taurus bta-miR-454
    3. Capra hircus (goat) chi-miR-454-3p
    4. Cervus elaphus cel-miR-454
    5. Chiloscyllium plagiosum microRNA cpl-miR-454-3p
    6. Equus caballus eca-miR-454
    7. Gadus morhua gmo-miR-454-3p
    8. Gallus gallus gga-miR-454-3p
    9. Homo sapiens hsa-miR-454-3p
    10. Ictalurus punctatus ipu-miR-454b
    11. Macaca mulatta mml-miR-454-3p
    12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-454
    13. Ornithorhynchus anatinus (platypus) oan-miR-454-3p
    14. Sarcophilus harrisii sha-miR-454
    15. Sus scrofa ssc-miR-454
    16. Taeniopygia guttata tgu-miR-454-3p
    17. Xenopus tropicalis (tropical clawed frog) xtr-miR-454-3p
    Publications