Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-146b-3p URS00004F546B_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-146b: Mmu-mir-146b is an up-regulated miRNA that is associated with various biological processes and diseases. It has been observed to be up-regulated in response to HFD-induced obesity and S. japonicum infection [PMC3319598] [PMC3692539]. The upregulation of mmu-mir-146b in S. japonicum-infected mice may reflect the recruitment and activation of B and T lymphocytes in response to antigens secreted by the eggs [PMC3692539]. LNA-containing primers were designed to quantify mmu-mir-146b, along with other hard-to-amplify miRNAs, in order to overcome technical challenges [PMC3030602]. In silico analysis has also shown significant correlations between mmu-mir-146b and modulations of mRNAs related to apoptosis processes [PMC3030602]. Mmu-mir-146b has been found to regulate the NFkB signaling pathway, indicating its involvement in immune responses [PMC4077261]. It has also been observed that mmu-mir-146b is significantly up-regulated during mid-phase infection with S. japonicum [PMC5390025] [PMC3692539]. Mmu-mir-146b is one of the 22 murine microRNAs selected for qPCR validation of their expression, indicating its importance in various biological processes [PMC3319598]. Mmu-miR-21, mmu-let-7c, mmu-miR-146a, and mmu-miR-378 are among the most abundant miRNAs along with mmu-mir-146b in both libraries studied [PMC3421232].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCUAGGGACUCAGUUCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cricetulus griseus cgr-miR-146b-3p
Publications