Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-592 URS00004F507C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-592: hsa-mir-592 is a microRNA that has been studied in various contexts. It has been found to show correlation with monosomy 3 tumors [PMC7958896]. In breast cancer samples, hsa-mir-592 expression was significantly higher compared to healthy samples and was found to regulate the extrinsic prothrombin activation pathway [PMC6208346]. Additionally, hsa-mir-592 is part of a group of 9 miRNAs that regulate the extrinsic and intrinsic prothrombin pathways [PMC4512830]. In a study comparing urinary bladder cancer patients and a control group, hsa-mir-592 was one of the microRNAs that showed statistically significant differences in expression [PMC5650163]. It has also been included in specific probes used for amplifying miRNAs in RNA samples [PMC8533892]. In terms of tumor metastasis, hsa-mir-592 was found to be upregulated in metastatic tumors compared to primary tumors [PMC7140886]. Furthermore, it was observed that hsa-mir-592 and other miRNAs were more highly deregulated in patients with high-grade disease compared to those with low-grade disease [PMC6423615]. Additionally, hsa-miR-599 and hsa-mir-592 were proposed as potential regulators of other mRNAs related to pRS [PMC8176413]. Furthermore, it has been suggested that hsa-mir-592 may indirectly affect TBEV replication [PMC9167876]. Finally, Kaplan-Meier analysis showed that hsa-mir-592 could effectively distinguish high-risk and low-risk groups in terms of prognosis [PMC9695425].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGUCAAUAUGCGAUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-592_5p (mature (guide))
  2. Canis lupus familiaris Cfa-Mir-592_5p (mature (guide))
  3. Capra hircus (goat) chi-miR-592
  4. Cavia porcellus Cpo-Mir-592_5p (mature (guide))
  5. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-592_5p (mature (guide))
  6. Echinops telfairi Ete-Mir-592_5p (mature (guide))
  7. Eptesicus fuscus efu-miR-592
  8. Equus caballus eca-miR-592
  9. Macaca mulatta (Rhesus monkey) mml-miR-592-5p
  10. Mus musculus (house mouse) Mmu-Mir-592_5p (mature (guide))
  11. Oryctolagus cuniculus (rabbit) Ocu-Mir-592_5p (mature (guide))
  12. Pan troglodytes ptr-miR-592
  13. Pongo pygmaeus ppy-miR-592
  14. Rattus norvegicus Rno-Mir-592_5p (mature (guide))
  15. Tupaia chinensis tch-miR-592
Publications