Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ursus americanus (American black bear) miRNA (ENSUAMG00000019596.1) secondary structure diagram

Ursus americanus (American black bear) miRNA (ENSUAMG00000019596.1) URS00004F4657_9643

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Ursus americanus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-145, RF00675). Ursus americanus (American black bear) miRNA (ENSUAMG00000019596.1) sequence is a product of ENSUAMG00000019596.1 gene. Found in the american black bear reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 85 other species

    1. Ailuropoda melanoleuca microRNA 145 (ENSAMEG00000020814.2)
    2. Aotus nancymaae miRNA (ENSANAG00000005543.1)
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) microRNA aja-mir-145 precursor
    4. Balaenoptera musculus (Blue whale) miRNA (ENSBMSG00010000932.1)
    5. Bison bison bison miRNA (ENSBBBG00000024584.1)
    6. Bos grunniens (domestic yak) microRNA 145 (ENSBGRG00000019262.1)
    7. Bos indicus x Bos taurus (hybrid cattle) microRNA 145 (ENSBIXG00000026819.1, ENSBIXG00005007667.1)
    8. Bos mutus (wild yak) microRNA 145 (ENSBMUG00000014905.1)
    9. Bos taurus (cattle) microRNA bta-mir-145 precursor
    10. Camelus dromedarius microRNA 145 (ENSCDRG00005002968.1)
    11. Capra hircus microRNA chi-mir-145 precursor
    12. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000003752.1)
    13. Delphinapterus leucas (beluga whale) microRNA 145 (ENSDLEG00000003977.1)
    14. Echinops telfairi miRNA (ENSETEG00000020894.1)
    15. Equus asinus asinus (donkey) microRNA 145 (ENSEASG00005002858.1)
    16. Equus caballus miRNA (ENSECAG00000026203.2)
    17. Felis catus (domestic cat) miRNA (ENSFCAG00000026678.3)
    18. Gorilla gorilla gorilla ggo-mir-145 (ENSGGOG00000028933.2)
    19. Gorilla gorilla (western gorilla) microRNA ggo-mir-145 precursor
    20. Homo sapiens (human) microRNA hsa-mir-145 precursor
    21. Loxodonta africana (African savanna elephant) microRNA 145 (ENSLAFG00000029552.1)
    22. Lynx canadensis microRNA 145 (ENSLCNG00005006296.1)
    23. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000018191.3)
    24. Monodon monoceros (narwhal) miRNA (ENSMMNG00015001524.1)
    25. Moschus moschiferus microRNA 145 (ENSMMSG00000000428.1)
    26. Mustela putorius furo (Domestic ferret) microRNA 145 (ENSMPUG00000021486.1)
    27. Neovison vison microRNA 145 (ENSNVIG00000001711.1)
    28. Nomascus leucogenys miRNA (ENSNLEG00000020983.2)
    29. Ovis aries (sheep) miRNA (ENSOARG00000024033.1, ENSOARG00020009871.1)
    30. Pan paniscus miRNA (ENSPPAG00000019447.1)
    31. Panthera leo microRNA 145 (ENSPLOG00000002119.1)
    32. Panthera pardus microRNA 145 (ENSPPRG00000013729.1)
    33. Panthera tigris altaica (Tiger) microRNA 145 (ENSPTIG00000003046.1)
    34. Pan troglodytes (chimpanzee) microRNA ptr-mir-145 precursor
    35. Phocoena sinus (vaquita) miRNA (ENSPSNG00000019401.1)
    36. Physeter catodon microRNA 145 (ENSPCTG00005000302.1)
    37. Pongo abelii microRNA 145 (ENSPPYG00000021565.1)
    38. Pongo pygmaeus microRNA ppy-mir-145 precursor
    39. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000024243.1)
    40. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000000901.1)
    41. Tupaia belangeri microRNA 145 (ENSTBEG00000017862.1)
    42. Tursiops truncatus microRNA 145 (ENSTTRG00000023926.1)
    43. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000005415.1)
    44. Ursus thibetanus thibetanus microRNA 145 (ENSUTTG00000001524.1)
    45. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015001106.1)
    2D structure New