Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ursus thibetanus thibetanus (Asiatic black bear) microRNA 145 secondary structure diagram

Ursus thibetanus thibetanus (Asiatic black bear) microRNA 145 URS00004F4657_441215

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Ursus thibetanus thibetanus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-145, RF00675). Found in the asiatic black bear reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 145 (MIR145)
    2. Aotus nancymaae miRNA
    3. Artibeus jamaicensis microRNA aja-mir-145 precursor
    4. Balaenoptera musculus miRNA
    5. Bison bison bison (American bison) miRNA
    6. Bos grunniens (domestic yak) microRNA 145
    7. Bos indicus x Bos taurus microRNA 145
    8. Bos mutus microRNA 145
    9. Bos taurus (cattle) microRNA bta-mir-145 precursor
    10. Camelus dromedarius (Arabian camel) microRNA 145
    11. Capra hircus (goat) microRNA chi-mir-145 precursor
    12. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    13. Delphinapterus leucas microRNA 145
    14. Echinops telfairi miRNA
    15. Equus asinus asinus (donkey) microRNA 145
    16. Equus caballus (horse) miRNA
    17. Felis catus (domestic cat) miRNA
    18. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-145
    19. Gorilla gorilla microRNA ggo-mir-145 precursor
    20. Homo sapiens microRNA hsa-mir-145 precursor
    21. Loxodonta africana microRNA 145
    22. Lynx canadensis (Canada lynx) microRNA 145
    23. Microcebus murinus miRNA
    24. Monodon monoceros (narwhal) miRNA
    25. Moschus moschiferus microRNA 145
    26. Mustela putorius furo (Domestic ferret) microRNA 145
    27. Neovison vison microRNA 145
    28. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    29. Ovis aries miRNA
    30. Pan paniscus (bonobo) miRNA
    31. Panthera leo (lion) microRNA 145
    32. Panthera pardus microRNA 145
    33. Panthera tigris altaica (Tiger) microRNA 145
    34. Pan troglodytes (chimpanzee) microRNA ptr-mir-145 precursor
    35. Phocoena sinus (vaquita) miRNA
    36. Physeter catodon (sperm whale) microRNA 145
    37. Pongo abelii microRNA 145
    38. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-145 precursor
    39. Prolemur simus miRNA
    40. Saimiri boliviensis boliviensis miRNA
    41. Tupaia belangeri microRNA 145
    42. Tursiops truncatus (bottlenosed dolphin) microRNA 145
    43. Ursus americanus (American black bear) miRNA
    44. Ursus maritimus (Polar bear) miRNA
    45. Zalophus californianus miRNA
    2D structure New