Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bison bison bison (American bison) miRNA secondary structure diagram

Bison bison bison (American bison) miRNA URS00004F4657_43346

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Bison bison bison. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-145, RF00675). Found in the american bison reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 145 (MIR145)
    2. Aotus nancymaae miRNA
    3. Artibeus jamaicensis microRNA aja-mir-145 precursor
    4. Balaenoptera musculus miRNA
    5. Bos grunniens (domestic yak) microRNA 145
    6. Bos indicus x Bos taurus microRNA 145
    7. Bos mutus microRNA 145
    8. Bos taurus (cattle) microRNA bta-mir-145 precursor
    9. Camelus dromedarius (Arabian camel) microRNA 145
    10. Capra hircus (goat) microRNA chi-mir-145 precursor
    11. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    12. Delphinapterus leucas microRNA 145
    13. Echinops telfairi miRNA
    14. Equus asinus asinus (donkey) microRNA 145
    15. Equus caballus (horse) miRNA
    16. Felis catus (domestic cat) miRNA
    17. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-145
    18. Gorilla gorilla microRNA ggo-mir-145 precursor
    19. Homo sapiens microRNA hsa-mir-145 precursor
    20. Loxodonta africana microRNA 145
    21. Lynx canadensis (Canada lynx) microRNA 145
    22. Microcebus murinus miRNA
    23. Monodon monoceros (narwhal) miRNA
    24. Moschus moschiferus microRNA 145
    25. Mustela putorius furo (Domestic ferret) microRNA 145
    26. Neovison vison microRNA 145
    27. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    28. Ovis aries miRNA
    29. Pan paniscus (bonobo) miRNA
    30. Panthera leo (lion) microRNA 145
    31. Panthera pardus microRNA 145
    32. Panthera tigris altaica (Tiger) microRNA 145
    33. Pan troglodytes (chimpanzee) microRNA ptr-mir-145 precursor
    34. Phocoena sinus (vaquita) miRNA
    35. Physeter catodon (sperm whale) microRNA 145
    36. Pongo abelii microRNA 145
    37. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-145 precursor
    38. Prolemur simus miRNA
    39. Saimiri boliviensis boliviensis miRNA
    40. Tupaia belangeri microRNA 145
    41. Tursiops truncatus (bottlenosed dolphin) microRNA 145
    42. Ursus americanus (American black bear) miRNA
    43. Ursus maritimus (Polar bear) miRNA
    44. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 145
    45. Zalophus californianus miRNA
    2D structure New