Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4713-5p URS00004F12D0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4713: Hsa-mir-4713 is a miRNA that was observed to be part of a 16-miRNA signature that showed a similar ability to classify LUAD pathological stages as combinations of 42 or 26 miRNAs [PMC7138293]. In the intersection of two datasets, hsa-mir-4713 was found to be one of the five differential miRNAs [PMC8986441]. In adipose tissue, hsa-mir-4713 was significantly downregulated compared to normal tissue [PMC8986441]. Additionally, hsa-mir-4713 was significantly lower in the obese and obese with fracture groups compared to the normal group in clinical validation [PMC8986441]. Through bioinformatics analyses, it was discovered that hsa-mir-4713 and another miRNA, hsa-mir-452, were differentially expressed in obese and normal human adipocyte-derived exosomes and interacted with NPY1R [PMC8986441]. It can be hypothesized that the expression of hsa-mir-4713 and hsa-mir-452 is associated with obesity rather than fractures [PMC8986441]. Furthermore, it was found that both hsa-mir-4713 and hsa-mir-452 interacted with NPY1R [PMC8986441]. References: [PMC7138293] - Zhang Y et al. (2020) Identification of key genes associated with pathological stages in lung adenocarcinoma via integrated bioinformatics analysis. PeerJ. 8:e8758. [PMC8986441] - Zhang Y et al. (2020) Identification of differentially expressed exosomal microRNAs in obesity by bioinformatics analysis. PeerJ. 8:e10442.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCUCCCACUACCAGGCUCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications