Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-705 URS00004EF889_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-705: Mmu-mir-705 is a microRNA that has been found to be directly correlated to angiogenesis [PMC6247691]. It is one of the top-rated miRNAs that have been identified to have vital regulatory effects in the network [PMC6247691]. Mmu-mir-705 has also been shown to target genes in the PI3K/Akt signal pathway related to ischemic cerebral angiogenesis [PMC6247691]. In addition, it has been observed to be involved in a large number of gene ontology annotations [PMC6247691]. Mmu-mir-705 has been detected using LNA-modified detection probes labeled with -dATP [PMC4103684]. It has also been detected using radioactive locked nucleic acid (LNA)-based ISH with unlabeled detection probes [PMC4103684]. Mmu-mir-705 has been found to be a negative regulator of osteoblast differentiation by targeting HOXA10 and Runx2 genes, and its expression is enhanced in ovariectomized mice through the TNF-α activated NF-kB pathway [PMC7116989]. Furthermore, it has been predicted to be involved in a network related to mmu_circRNA_21040 and its target genes have also been identified [PMC9574125]. Overall, mmu-mir-705 plays important roles in angiogenesis, osteoblast differentiation, and gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGGGAGGUGGGGUGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications