Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-136 URS00004EAB18_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-136: Bta-mir-136 is a hub miRNA that is involved in various biological processes [PMC6637853]. It is expressed at a higher level in Wagyu cattle compared to Holstein cattle [PMC6637853]. In cows with negative energy status, bta-mir-136 is one of the miRNAs found on chromosome 21 [PMC6731312]. Humans also have identical miRNAs to bta-mir-136, such as hsa-miR-136 [PMC8787201]. The RTL1 gene is targeted by the greatest number of miRNAs, including bta-mir-136, in both humans and cattle [PMC8787201]. The nucleotide sequence of bta-mir-136 has full complementarity to 13 mRNAs of human genes [PMC8787201]. Bta-mir-136 has been detected in bovine milk and colostrum [PMC8787201]. Overall, bta-mir-136 is a hub miRNA that plays a role in various biological processes and shows differential expression between cattle breeds. It also has similarities with human miRNAs and targets the RTL1 gene. Additionally, it can be found in bovine milk and colostrum.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCCAUUUGUUUUGAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Canis lupus familiaris (dog) cfa-miR-136
  2. Cavia porcellus (domestic guinea pig) cpo-miR-136-5p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-136-5p
  4. Gorilla gorilla gorilla ggo-miR-136 (MIR136)
  5. Gorilla gorilla ggo-miR-136
  6. Homo sapiens hsa-miR-136-5p
  7. Macaca mulatta mml-miR-136
  8. Mus musculus Mmu-Mir-136-v1_5p (mature (co-guide))
  9. Oryctolagus cuniculus ocu-miR-136-5p
  10. Ovis aries oar-miR-136
  11. Pan paniscus (pygmy chimpanzee) ppa-miR-136
  12. Pan troglodytes (chimpanzee) ptr-miR-136
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-136
  14. Pteropus alecto (black flying fox) pal-miR-136-5p
  15. Rattus norvegicus (Norway rat) rno-miR-136-5p
  16. Sus scrofa ssc-miR-136-5p
  17. Tupaia chinensis (Chinese tree shrew) tch-miR-136-5p
Publications