Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-136-5p URS00004EAB18_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCCAUUUGUUUUGAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-136
  2. Canis lupus familiaris (dog) cfa-miR-136
  3. Cavia porcellus (domestic guinea pig) cpo-miR-136-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-136-5p
  5. Gorilla gorilla gorilla ggo-miR-136 (MIR136)
  6. Gorilla gorilla ggo-miR-136
  7. Homo sapiens hsa-miR-136-5p
  8. Macaca mulatta mml-miR-136
  9. Mus musculus Mmu-Mir-136-v1_5p (mature (co-guide))
  10. Oryctolagus cuniculus ocu-miR-136-5p
  11. Ovis aries oar-miR-136
  12. Pan paniscus (pygmy chimpanzee) ppa-miR-136
  13. Pan troglodytes (chimpanzee) ptr-miR-136
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-136
  15. Rattus norvegicus (Norway rat) rno-miR-136-5p
  16. Sus scrofa ssc-miR-136-5p
  17. Tupaia chinensis (Chinese tree shrew) tch-miR-136-5p