Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-136-5p URS00004EAB18_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, PSICQUIC, GeneCards, LncBase, MalaCards, TarBase, ENA, RefSeq, miRBase). Described in 46 papers. Homo sapiens (human) hsa-miR-136-5p sequence is a product of hsa-miR-136-5p, hsa-miR-136, miR-136-5p, MIR136, miR-136 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 16.3A5, 2H9, 4.1R, 8B, A20, ABBP1, ABC28, ABCC5, ABCF2.

Interactions 18

According to PSICQUIC, Homo sapiens (human) hsa-miR-136-5p interacts with:

Interaction id Participant Synonyms
URS00004EAB18_9606-0 O15492 O15492
URS00004EAB18_9606-9 O15492 O15492
URS00004EAB18_9606-10 P05231 P05231
URS00004EAB18_9606-1 P05231 P05231
URS00004EAB18_9606-2 P15336 P15336
URS00004EAB18_9606-11 P15336 P15336
URS00004EAB18_9606-3 Q01094 Q01094
URS00004EAB18_9606-12 Q01094 Q01094
URS00004EAB18_9606-4 Q16533 Q16533
URS00004EAB18_9606-13 Q16533 Q16533
URS00004EAB18_9606-5 Q16552 Q16552
URS00004EAB18_9606-14 Q16552 Q16552
URS00004EAB18_9606-15 Q86V24 Q86V24
URS00004EAB18_9606-6 Q86V24 Q86V24
URS00004EAB18_9606-16 Q8N4C8 Q8N4C8
URS00004EAB18_9606-7 Q8N4C8 Q8N4C8
URS00004EAB18_9606-8 Q9GZU0 Q9GZU0
URS00004EAB18_9606-17 Q9GZU0 Q9GZU0

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUCCAUUUGUUUUGAUGAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Bos taurus (cattle) bta-miR-136
    2. Canis lupus familiaris (dog) cfa-miR-136
    3. Cavia porcellus cpo-miR-136-5p
    4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-136-5p
    5. Echinops telfairi Ete-Mir-136-v1_5p* (star (passenger))
    6. Gorilla gorilla (western gorilla) ggo-miR-136
    7. Macaca mulatta mml-miR-136
    8. Mus musculus Mmu-Mir-136-v1_5p (mature (co-guide))
    9. Oryctolagus cuniculus ocu-miR-136-5p
    10. Ovis aries (sheep) oar-miR-136
    11. Pan paniscus ppa-miR-136
    12. Pan troglodytes (chimpanzee) ptr-miR-136
    13. Pongo pygmaeus ppy-miR-136
    14. Pteropus alecto (black flying fox) pal-miR-136-5p
    15. Rattus norvegicus rno-miR-136-5p
    16. Sus scrofa ssc-miR-136-5p
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-136-5p