Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-bantam-3p URS00004E9E38_7244

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUCAUUUUGAAAGCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aedes aegypti Aae-Bantam_3p (mature (guide))
  2. Cochliomyia hominivorax (primary screw-worm) mature cho-bantam-3p
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-bantam-3p
  4. Drosophila ananassae dan-bantam
  5. Drosophila erecta der-bantam
  6. Drosophila grimshawi dgr-bantam
  7. Drosophila melanogaster dme-bantam-3p
  8. Drosophila mojavensis dmo-bantam
  9. Drosophila persimilis dpe-bantam
  10. Drosophila pseudoobscura dps-bantam
  11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294525_df_nrg
  12. Drosophila sechellia dse-bantam
  13. Drosophila simulans dsi-bantam
  14. Drosophila willistoni dwi-bantam
  15. Drosophila yakuba dya-bantam