Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-29a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-29a precursor URS00004E9304_9606

  • 64 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 66 species

Automated summary: This pre miRNA sequence is 64 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Rfam, GeneCards, MalaCards, RefSeq, ENA, HGNC, Ensembl/GENCODE, Ensembl, miRBase). Described in 67 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-29, RF00074). Homo sapiens (human) microRNA hsa-mir-29a precursor sequence is a product of ENSG00000284032.1, mir-29 microRNA precursor, mir-29a precurso, hsa-mir-29a precursor, 29 microRNA precurso, mir-29a precursor, MIR29A, 29 microRNA precursor, mir-29a genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Ailuropoda melanoleuca mir-29 microRNA precursor
    2. Aotus nancymaae miRNA (ENSANAG00000013314.1)
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-29a precursor
    4. Bos taurus microRNA bta-mir-29a precursor
    5. Callithrix jacchus mir-29 microRNA precursor
    6. Canis lupus familiaris mir-29 microRNA precursor
    7. Capra hircus microRNA mir-29a (ENSCHIG00000009009.1)
    8. Carlito syrichta miRNA (ENSTSYG00000023617.2)
    9. Cavia porcellus mir-29 microRNA precursor
    10. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015753.1)
    11. Chlorocebus sabaeus mir-29 microRNA precursor
    12. Colobus angolensis palliatus miRNA (ENSCANG00000037675.1)
    13. Equus caballus mir-29 microRNA precursor
    14. Felis catus mir-29 microRNA precursor
    15. Fukomys damarensis mir-29 microRNA precursor
    16. Gorilla gorilla gorilla ggo-mir-29a (ENSGGOG00000032853.2)
    17. Gorilla gorilla (western gorilla) microRNA ggo-mir-29a precursor
    18. Heterocephalus glaber mir-29 microRNA precursor
    19. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-29a precursor
    20. Loxodonta africana mir-29 microRNA precursor
    21. Macaca fascicularis (Crab-eating macaque) miRNA
    22. Macaca mulatta microRNA mml-mir-29a precursor
    23. Macaca nemestrina microRNA mne-mir-29a precursor
    24. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013113.1)
    25. Marmota monax non-coding RNA
    26. Microcebus murinus (gray mouse lemur) mmr-mir-29a (ENSMICG00000018399.3)
    27. Nomascus leucogenys nle-mir-29a (ENSNLEG00000024513.2)
    28. Otolemur garnettii mir-29 microRNA precursor
    29. Ovis aries (sheep) microRNA oar-mir-29a precursor
    30. Pan paniscus microRNA ppa-mir-29a precursor
    31. Panthera pardus microRNA 29a (ENSPPRG00000014670.1)
    32. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000001473.1)
    33. Pan troglodytes microRNA ptr-mir-29a precursor
    34. Papio anubis miRNA (ENSPANG00000003533.2)
    35. Pongo abelii mir-29 microRNA precursor
    36. Pongo pygmaeus microRNA ppy-mir-29a precursor
    37. Propithecus coquereli miRNA (ENSPCOG00000008303.1)
    38. Rhinopithecus bieti miRNA (ENSRBIG00000008246.1)
    39. Rhinopithecus roxellana miRNA (ENSRROG00000002738.1)
    40. Saguinus labiatus microRNA sla-mir-29a precursor
    41. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000036361.1)
    42. Ictidomys tridecemlineatus mir-29 microRNA precursor
    43. Sus scrofa mir-29 microRNA precursor
    44. Tupaia chinensis mir-29 microRNA precursor
    2D structure New