Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-532-5p URS00004E8341_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, TarBase, miRBase, LncBase, RefSeq, MirGeneDB, MalaCards, ENA). Homo sapiens (human) hsa-miR-532-5p sequence is a product of MIR532, miR-532-5p, miR-532, hsa-miR-532-5p, hsa-miR-532 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16.3A5, 18A2, 2-COP, 20D7-FC4, 39K2, 42A, 8B, ABHD13, ABS, ACAD9.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAUGCCUUGAGUGUAGGACCGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus bta-miR-532
    2. Callithrix jacchus cja-miR-532
    3. Canis lupus familiaris cfa-miR-532
    4. Capra hircus (goat) chi-miR-532-5p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-532-5p
    6. Cervus elaphus (red deer) cel-miR-532
    7. Cricetulus griseus cgr-miR-532-5p
    8. Equus caballus eca-miR-532-5p
    9. Macaca mulatta mml-miR-532-5p
    10. Microcebus murinus (gray mouse lemur) mmr-miR-532
    11. Mus musculus (house mouse) mmu-miR-532-5p
    12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-532
    13. Papio hamadryas pha-miR-532
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-532-5p
    15. Sus scrofa (pig) ssc-miR-532-5p
    16. Tupaia chinensis (Chinese tree shrew) tch-miR-532-5p
    Publications New