Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-129-5p URS00004E1410_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MirGeneDB, PSICQUIC, GeneCards, LncBase, MalaCards, TarBase, IntAct, ENA, RefSeq, miRBase). Described in 74 papers. Homo sapiens (human) hsa-miR-129-5p sequence is a product of miR-129, mir-129-2, MIR129-1, miR-129-5p, MIR129-2, 129-2, hsa-miR-129-5p, hsa-miR-129 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 182-FIP, 2310047H23Rik, 3D3, 3OST1, 82-FIP, A121, A28-RGS14, AA, ABC20.

Interactions 17

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-129-5p interacts with:

Interaction id Participant Synonyms
EBI-20584904 intact:EBI-20584899 EBI-20584899 ENST00000391807.5 mrna_klk7
EBI-25610364 intact:EBI-25610370 EBI-25610370 ENST00000239938 mrna_egr1
EBI-25612021 intact:EBI-25612250 EBI-25612250 ENST00000356245.8 mrna_g3bp1
URS00004E1410_9606-0 O15440 O15440
URS00004E1410_9606-7 O15440 O15440
URS00004E1410_9606-1 P08183 P08183
URS00004E1410_9606-8 P08183 P08183
URS00004E1410_9606-9 P10145 P10145
URS00004E1410_9606-2 P10145 P10145
URS00004E1410_9606-10 P35968 P35968
URS00004E1410_9606-3 P35968 P35968
URS00004E1410_9606-11 P45844 P45844
URS00004E1410_9606-4 P45844 P45844
URS00004E1410_9606-5 P49841 P49841
URS00004E1410_9606-12 P49841 P49841
URS00004E1410_9606-13 Q06787 Q06787
URS00004E1410_9606-6 Q06787 Q06787

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUUUGCGGUCUGGGCUUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 112 other species

    1. Alligator mississippiensis ami-miR-129a-5p
    2. Anolis carolinensis aca-miR-129a-5p
    3. Bos taurus (cattle) Bta-Mir-129-P1_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-129
    5. Callorhinchus milii (elephant shark) eshark_mir-129_1
    6. Canis lupus familiaris (dog) cfa-miR-129
    7. Capra hircus chi-miR-129-5p
    8. Cavia porcellus cpo-miR-129-5p
    9. Cervus elaphus (red deer) cel-miR-129
    10. Chiloscyllium plagiosum microRNA cpl-miR-129
    11. Chrysemys picta bellii Cpi-Mir-129-P1_5p (mature (guide))
    12. Chrysemys picta cpi-miR-129-5p
    13. Columba livia cli-miR-129-5p
    14. Cricetulus griseus (Chinese hamster) cgr-miR-129
    15. Cyprinus carpio (common carp) ccr-miR-129
    16. Danio rerio Dre-Mir-129-P1b_5p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-129-5p
    18. Echinops telfairi Ete-Mir-129-P2_5p (mature (co-guide))
    19. Equus caballus eca-miR-129a-5p
    20. Gadus morhua (Atlantic cod) gmo-miR-129-3-5p
    21. Gallus gallus (chicken) gga-miR-129-5p
    22. Haplochromis burtoni abu-miR-129
    23. Ictalurus punctatus ipu-miR-129
    24. Macaca mulatta mml-miR-129-5p
    25. Maylandia zebra (zebra mbuna) mze-miR-129
    26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-129-P1_5p (mature (guide))
    27. Mus musculus mmu-miR-129-5p
    28. Neolamprologus brichardi nbr-miR-129
    29. Oreochromis niloticus (Nile tilapia) oni-miR-129
    30. Ornithorhynchus anatinus oan-miR-129-5p
    31. Oryctolagus cuniculus ocu-miR-129-5p
    32. Pan troglodytes (chimpanzee) ptr-miR-129
    33. Pongo pygmaeus ppy-miR-129-5p
    34. Pteropus alecto (black flying fox) pal-miR-129b-5p
    35. Pundamilia nyererei pny-miR-129
    36. Python bivittatus pbv-miR-129a-5p
    37. Rattus norvegicus rno-miR-129-5p
    38. Salmo salar ssa-miR-129-5p
    39. Sarcophilus harrisii (Tasmanian devil) sha-miR-129
    40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-129-P1_5p (mature (guide))
    41. Sus scrofa ssc-miR-129a-5p
    42. Taeniopygia guttata (zebra finch) tgu-miR-129-5p
    43. Tupaia chinensis (Chinese tree shrew) tch-miR-129-5p
    44. Xenopus tropicalis xtr-miR-129