Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-129-5p URS00004E1410_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (miRBase, RefSeq, LncBase, ENA, MirGeneDB, TarBase, PirBase). Described in 22 papers. Mus musculus (house mouse) mmu-miR-129-5p sequence is a product of Mir129-1, miR-129-5p, mmu-miR-129-5p, mmu-miR-129, miR-129, Mir129-2 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110001M19Rik, 1110003E12Rik, 1110029L17Rik, 1110038H03Rik, 1110061E11Rik, 1700121L09Rik, 2310051F07Rik, 2700038K18Rik, 2900045N06Rik, 4930555L11Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUUUGCGGUCUGGGCUUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 112 other species

    1. Alligator mississippiensis ami-miR-129a-5p
    2. Anolis carolinensis aca-miR-129a-5p
    3. Bos taurus (cattle) Bta-Mir-129-P1_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-129
    5. Callorhinchus milii (elephant shark) eshark_mir-129_1
    6. Canis lupus familiaris (dog) cfa-miR-129
    7. Capra hircus chi-miR-129-5p
    8. Cavia porcellus cpo-miR-129-5p
    9. Cervus elaphus (red deer) cel-miR-129
    10. Chiloscyllium plagiosum microRNA cpl-miR-129
    11. Chrysemys picta bellii Cpi-Mir-129-P1_5p (mature (guide))
    12. Chrysemys picta cpi-miR-129-5p
    13. Columba livia cli-miR-129-5p
    14. Cricetulus griseus (Chinese hamster) cgr-miR-129
    15. Cyprinus carpio (common carp) ccr-miR-129
    16. Danio rerio Dre-Mir-129-P1b_5p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-129-5p
    18. Echinops telfairi Ete-Mir-129-P2_5p (mature (co-guide))
    19. Equus caballus eca-miR-129a-5p
    20. Gadus morhua (Atlantic cod) gmo-miR-129-3-5p
    21. Gallus gallus (chicken) gga-miR-129-5p
    22. Haplochromis burtoni abu-miR-129
    23. Homo sapiens (human) hsa-miR-129-5p
    24. Ictalurus punctatus ipu-miR-129
    25. Macaca mulatta mml-miR-129-5p
    26. Maylandia zebra (zebra mbuna) mze-miR-129
    27. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-129-P1_5p (mature (guide))
    28. Neolamprologus brichardi nbr-miR-129
    29. Oreochromis niloticus (Nile tilapia) oni-miR-129
    30. Ornithorhynchus anatinus oan-miR-129-5p
    31. Oryctolagus cuniculus ocu-miR-129-5p
    32. Pan troglodytes (chimpanzee) ptr-miR-129
    33. Pongo pygmaeus ppy-miR-129-5p
    34. Pteropus alecto (black flying fox) pal-miR-129b-5p
    35. Pundamilia nyererei pny-miR-129
    36. Python bivittatus pbv-miR-129a-5p
    37. Rattus norvegicus rno-miR-129-5p
    38. Salmo salar ssa-miR-129-5p
    39. Sarcophilus harrisii (Tasmanian devil) sha-miR-129
    40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-129-P1_5p (mature (guide))
    41. Sus scrofa ssc-miR-129a-5p
    42. Taeniopygia guttata (zebra finch) tgu-miR-129-5p
    43. Tupaia chinensis (Chinese tree shrew) tch-miR-129-5p
    44. Xenopus tropicalis xtr-miR-129