Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-98-5p URS00004E0808_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, RefSeq, PSICQUIC, MirGeneDB, ENA, miRBase, LncBase, MalaCards, GeneCards, IntAct). Homo sapiens (human) hsa-miR-98-5p sequence is a product of MIR98, hsa-miR-98, 98, miR-98-5p, hsa-miR-98-5p, miR-98 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 182-FIP, 1A6/DRIM, 2610509L04Rik, 2OST.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-98-5p interacts with:

Interaction id Participant Synonyms
EBI-26447224 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25470258 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS00004E0808_9606-0 O00264 O00264
URS00004E0808_9606-9 O00264 O00264
URS00004E0808_9606-2 P05231 P05231
URS00004E0808_9606-11 P05231 P05231
URS00004E0808_9606-10 P05231 P05231
URS00004E0808_9606-1 P05231 P05231
URS00004E0808_9606-12 P05305 P05305
URS00004E0808_9606-3 P05305 P05305
URS00004E0808_9606-4 P11511 P11511
URS00004E0808_9606-13 P11511 P11511
URS00004E0808_9606-6 P22301 P22301
URS00004E0808_9606-14 P22301 P22301
URS00004E0808_9606-5 P22301 P22301
URS00004E0808_9606-7 P40763 P40763
URS00004E0808_9606-8 Q9UNH7 Q9UNH7
URS00004E0808_9606-15 Q9UNH7 Q9UNH7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAAGUUGUAUUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Anolis carolinensis (green anole) Aca-Let-7-P2b3_5p (mature (guide))
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-98
    3. Bos taurus (cattle) bta-miR-98
    4. Callithrix jacchus cja-miR-98
    5. Canis lupus familiaris cfa-miR-98
    6. Capra hircus (goat) chi-miR-98-5p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-98-5p
    8. Cervus elaphus (red deer) cel-miR-98
    9. Cricetulus griseus cgr-miR-98
    10. Dasypus novemcinctus dno-miR-98-5p
    11. Daubentonia madagascariensis dma-miR-98
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b3_5p (mature (guide))
    13. Equus caballus (horse) eca-miR-98
    14. Gekko japonicus Gja-Let-7-P2b3_5p (mature (guide))
    15. Gorilla gorilla (western gorilla) ggo-miR-98
    16. Macaca mulatta (Rhesus monkey) mml-miR-98
    17. Microcaecilia unicolor Mun-Let-7-P2b3_5p (mature (guide))
    18. Microcebus murinus (gray mouse lemur) mmr-miR-98
    19. Mus musculus mmu-miR-98-5p
    20. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-98
    21. Ophiophagus hannah (king cobra) oha-miR-98-5p
    22. Ornithorhynchus anatinus (platypus) oan-miR-98
    23. Oryctolagus cuniculus ocu-miR-98-5p
    24. Otolemur garnettii (small-eared galago) oga-miR-98
    25. Ovis aries miscellaneous RNA
    26. Pan paniscus ppa-miR-98
    27. Pan troglodytes (chimpanzee) ptr-miR-98
    28. Papio hamadryas pha-miR-98
    29. Pongo pygmaeus ppy-miR-98
    30. Pteropus alecto (black flying fox) pal-miR-98-5p
    31. Python bivittatus (Burmese python) pbv-miR-98-5p
    32. Rattus norvegicus rno-miR-98-5p
    33. Sphenodon punctatus Spt-Let-7-P2b3_5p (mature (guide))
    34. Sus scrofa (pig) ssc-miR-98
    35. Tupaia chinensis tch-miR-98-5p
    36. Tursiops truncatus miR-98
    37. Xenopus laevis xla-miR-98-5p
    38. Xenopus tropicalis (tropical clawed frog) xtr-miR-98
    Publications New