Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Triops cancriformis tcf-miR-71-5p URS00004DE0BE_194544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAAGACAUGGGUAGUGAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-71-5p
  2. Branchiostoma floridae bfl-miR-71-5p
  3. Branchiostoma lanceolatum Bla-Mir-71_5p (mature (guide))
  4. Hyalella azteca miR-71-5p
  5. Melitaea cinxia mir-71
  6. Patiria miniata (sea bat) pmi-miR-71-5p
  7. Penaeus japonicus miR-71
  8. Schmidtea mediterranea (freshwater planarian) sme-miR-71c-5p
  9. Tribolium castaneum tca-miR-71-5p