Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-711 URS00004DC6C5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-711: In a study analyzing GSE46823 and GSE83292 datasets, hsa-mir-711 was found to be down-regulated along with other miRNAs [PMC9812810]. Another study found that hsa-mir-711 showed the lowest expression in lymphoma compared to malignant tumors [PMC4673232]. Furthermore, hsa-mir-711 was found to be up-regulated in cutaneous T-cell lymphoma compared to benign inflammatory skin lesions [PMC4673232]. The expression of ZFP1, a downstream molecule, could be regulated by hsa-mir-711 mimics and hsa_circ_0008792 over-expression [PMC7073447]. The binding site between hsa_circ_0008792 and hsa-mir-711 was predicted by bioinformatics and confirmed by dual-luciferase reporter assay [PMC7073447]. Hsa_circ_0008792 could down-regulate the expression of hsa-mir-711 via sponge effect and up-regulate ZFP1 expression [PMC7073447]. Hsa-mir-711 may also be involved in the anti-inflammatory effects of ApN in human skeletal muscle [PMC5327483]. Hsa_mir-711 was identified as one of the miRNAs that frequently bound to circRNAs, suggesting its role in circRNA regulation [PMC7187532]. In addition, 29 MREs were identified for hsa_mir-711 along with 144 related target genes for a specific circRNA [PMC9451056]. The reverse transcription reaction for analyzing miRNA expression included specific primers for hsa_mir_711 [PMC7035283].\n[References: PMC9812810, PMC4673232, PMC7073447, PMC5327483, PMC7187532, PMC9451056, PMC7035283

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGACCCAGGGAGAGACGUAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Equus caballus (horse) eca-miR-711
  2. Macaca mulatta mml-miR-711
  3. Pan troglodytes (chimpanzee) ptr-miR-711
Publications