Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-30e-3p URS00004DC6A5_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30e-3p
  2. Anolis carolinensis aca-miR-30e-3p
  3. Canis lupus familiaris cfa-miR-30e
  4. Cervus elaphus cel-miR-30e-3p
  5. Chrysemys picta (Painted turtle) cpi-miR-30e-3p
  6. Cricetulus griseus cgr-miR-30e-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30e-3p
  8. Daubentonia madagascariensis dma-miR-30e
  9. Gallus gallus microRNA miR-30e-3p
  10. Homo sapiens (human) hsa-miR-30e-3p
  11. Mus musculus (house mouse) mmu-miR-30e-3p
  12. Ophiophagus hannah (king cobra) oha-miR-30e-3p
  13. Ornithorhynchus anatinus (platypus) oan-miR-30e-3p
  14. Oryctolagus cuniculus ocu-miR-30e-3p
  15. Pteropus alecto (black flying fox) pal-miR-30e-3p
  16. Python bivittatus (Burmese python) pbv-miR-30e-3p
  17. Rattus norvegicus rno-miR-30e-3p
  18. Sus scrofa (pig) ssc-miR-30e-3p
  19. Taeniopygia guttata tgu-miR-30a-3p
  20. Tursiops truncatus miR-30e-3p
  21. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1236967