Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-214-v1_5p* (star (passenger)) URS00004DAA89_9615

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 24 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGUCUACACUUGCUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Alligator mississippiensis (American alligator) ami-miR-214-5p
  2. Anolis carolinensis aca-miR-214-5p
  3. Capra hircus chi-miR-214-5p
  4. Cavia porcellus cpo-miR-214-5p
  5. Cervus elaphus cel-miR-214*
  6. Columba livia (rock pigeon) cli-miR-214-5p
  7. Cricetulus griseus cgr-miR-214-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-5p
  9. Gadus morhua (Atlantic cod) Gmo-Mir-214-P1_5p (mature (guide))
  10. Gallus gallus microRNA Ros-gga
  11. Homo sapiens (human) hsa-miR-214-5p
  12. Macaca mulatta mml-miR-214-5p
  13. Microcaecilia unicolor Mun-Mir-214_5p (mature (co-guide))
  14. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-5p
  15. Monopterus albus Mal-Mir-214-P1-v1_5p (mature (co-guide))
  16. Mus musculus (house mouse) mmu-miR-214-5p
  17. Ornithorhynchus anatinus (platypus) Oan-Mir-214-v1_5p (mature (co-guide))
  18. Oryctolagus cuniculus ocu-miR-214-5p
  19. Pteropus alecto (black flying fox) pal-miR-214-5p
  20. Python bivittatus (Burmese python) pbv-miR-214-5p
  21. Salmo salar (Atlantic salmon) ssa-miR-214-5p
  22. Sus scrofa (pig) ssc-miR-214-5p
  23. Taeniopygia guttata tgu-miR-214-5p
  24. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-214-P1-v1_5p (mature (guide))