Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-203a-3p URS00004DA9DB_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, miRBase, PSICQUIC, MirGeneDB, GeneCards, MalaCards, IntAct, LncBase, RefSeq, ENA). Homo sapiens (human) hsa-miR-203a-3p sequence is a product of miR-203a-3p, miR-203, hsa-miR-203a, hsa-miR-203a-3p, miR-203a, MIR203A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 123F2, 14-3-3, 156DAG, 182-FIP, 1A1-3B, 24p3, 2C18, 39K2, 3pK.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-203a-3p interacts with:

Interaction id Participant Synonyms
EBI-25425052 intact:EBI-25424500 EBI-25424500 ENST00000307407 mrna_il8
URS00004DA9DB_9606-0 O14543 O14543
URS00004DA9DB_9606-9 O14543 O14543
URS00004DA9DB_9606-1 O14544 O14544
URS00004DA9DB_9606-10 O14544 O14544
URS00004DA9DB_9606-11 P01375 P01375
URS00004DA9DB_9606-2 P01375 P01375
URS00004DA9DB_9606-4 P10145 P10145
URS00004DA9DB_9606-13 P10145 P10145
URS00004DA9DB_9606-12 P10145 P10145
URS00004DA9DB_9606-3 P10145 P10145
URS00004DA9DB_9606-14 Q07955 Q07955
URS00004DA9DB_9606-5 Q07955 Q07955
URS00004DA9DB_9606-6 Q13007 Q13007
URS00004DA9DB_9606-15 Q13007 Q13007
URS00004DA9DB_9606-7 Q9H3D4 Q9H3D4
URS00004DA9DB_9606-16 Q9H3D4 Q9H3D4
URS00004DA9DB_9606-8 Q9UDY2 Q9UDY2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGAAAUGUUUAGGACCACUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Bos taurus (cattle) Bta-Mir-203-v1_3p (mature (guide))
    2. Callithrix jacchus cja-miR-203
    3. Canis lupus familiaris cfa-miR-203
    4. Capra hircus (goat) miR-203
    5. Cavia porcellus (domestic guinea pig) cpo-miR-203-3p
    6. Cervus elaphus (red deer) cel-miR-203
    7. Dasypus novemcinctus Dno-Mir-203-v1_3p (mature (guide))
    8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-203-v1_3p (mature (guide))
    9. Macaca mulatta (Rhesus monkey) mml-miR-203
    10. Mus musculus mmu-miR-203-3p
    11. Oryctolagus cuniculus Ocu-Mir-203-v1_3p (mature (guide))
    12. Ovis aries miscellaneous RNA
    13. Pan troglodytes (chimpanzee) ptr-miR-203
    14. Pongo pygmaeus ppy-miR-203
    15. Rattus norvegicus rno-miR-203a-3p
    Publications New