Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-203-3p URS00004DA9DB_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-203: Mmu-mir-203 is a microRNA that has been studied in various contexts. It has been shown to be present in a plasmid sequence called PSilencer 4.1-CMV-Puro [PMC4649077]. Mmu-mir-203 is part of a cluster of miRNAs that includes mmu-miR-10a, mmu-mir-330, mmu-mir-342, mmu-mir-470, and mmu-mir-99b [PMC3937077]. These miRNAs have been identified as potential candidates for the protein Oct4 [PMC3937077]. Mmu-mir-203 has also been found to be involved in the MAPK signaling pathway ceRNA network, where it can regulate circRNA1709 and genes such as AKT3, MAPK9, FGF9, and IGF1R [PMC10048691]. Additionally, mmu-mir-203 has been identified as a potential target for several other miRNAs that are either upregulated or downregulated in different contexts [PMC3030602]. It has also been shown to target Zeb1 and Zeb2 genes involved in epithelial to mesenchymal transition [PMC3319598]. Mmu-mir-203 expression can be detected using specific LNATM miRNA primers [PMC3549733]. It is worth noting that the expression of mmu-miR-203 is downregulated in certain conditions such as HFD-induced obesity [PMC3319598]. Furthermore, it has been observed that the 3p arm of the mmu-miR-203 hairpin has a higher abundance than the 5p arm [PMC3919606]. Overall, these studies highlight the importance of mmu-miR-203 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications