Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR172d-3p URS00004D8ACB_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR172d-3p sequence is a product of osa-miR172d, miR172, miR172d-3p, miR172d, miR172a, osa-miR172a, osa-miR172d-3p genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAAUCUUGAUGAUGCUGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Aegilops tauschii ata-miR172b-3p
    2. Ananas comosus (pineapple) miR172
    3. Aquilegia coerulea aqc-miR172a
    4. Arabidopsis lyrata aly-miR172a-3p
    5. Arabidopsis thaliana ath-miR172b-3p
    6. Asparagus officinalis (garden asparagus) aof-miR172
    7. Brachypodium distachyon (stiff brome) bdi-miR172a-3p
    8. Brassica napus bna-miR172a
    9. Brassica oleracea bol-miR172b
    10. Brassica rapa (field mustard) bra-miR172a
    11. Camelina sativa cas-miR172b
    12. Citrus sinensis (sweet orange) csi-miR172b-3p
    13. Cucumis melo (muskmelon) cme-miR172c
    14. Cynara cardunculus cca-miR172
    15. Digitalis purpurea (common foxglove) dpr-miR172a
    16. Elaeis guineensis (African oil palm) egu-miR172a
    17. Eugenia uniflora eun-miR172a-3p
    18. Fragaria vesca subsp. vesca fve-miR172b
    19. Glycine max gma-miR172h-3p
    20. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr08g0218595
    21. Linum usitatissimum lus-miR172a
    22. Malus domestica (apple) mdm-miR172f
    23. Manihot esculenta mes-miR172d
    24. Medicago truncatula (barrel medic) mtr-miR172b
    25. Nicotiana tabacum nta-miR172h
    26. Oryza sativa osa-miR172a
    27. Populus tomentosa Pto-miR172c
    28. Populus trichocarpa ptc-miR172a
    29. Prunus persica (peach) ppe-miR172b
    30. Salvia sclarea ssl-miR172
    31. Solanum lycopersicum (tomato) sly-miR172b
    32. Solanum tuberosum stu-miR172b-3p
    33. Theobroma cacao (cacao) tcc-miR172b
    34. Vigna unguiculata (cowpea) vun-miR172
    35. Vriesea carinata vca-miR172a-3p