v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR169b URS00004D7772_4081

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAGCCAAGGAUGACUUGCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Aegilops tauschii ata-miR169i-5p
    2. Ananas comosus (pineapple) microRNA 169h
    3. Aquilegia coerulea aqc-miR169b
    4. Arabidopsis lyrata aly-miR169h-5p
    5. Arabidopsis thaliana ath-miR169k
    6. Brachypodium distachyon (stiff brome) bdi-miR169g
    7. Camelina sativa cas-miR169g-5p
    8. Cucumis melo cme-miR169n
    9. Gossypium herbaceum ghb-miR169a
    10. Gossypium hirsutum (cotton) ghr-miR169a
    11. Linum usitatissimum (flax) lus-miR169b
    12. Malus domestica mdm-miR169l
    13. Manihot esculenta mes-miR169u
    14. Musa AAB Group miR169
    15. Oryza sativa Japonica Group microRNA osa-miR169h
    16. Oryza sativa osa-miR169k
    17. Pachycladon fastigiatum Pfa-miR169h
    18. Populus tomentosa Pto-miR169m
    19. Populus trichocarpa ptc-miR169m
    20. Sorghum bicolor sbi-miR169l
    21. Theobroma cacao tcc-miR169j
    22. Zea mays zma-miR169j-5p
     Publications