Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169h URS00004D7772_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169h sequence is a product of osa-miR169h, osa-miR169m, osa-miR169j, miR169j, miR169l, osa-miR169k, osa-miR169l, miR169h, miR169k, miR169m, miR169 genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCCAAGGAUGACUUGCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Aegilops tauschii ata-miR169i-5p
    2. Ananas comosus (pineapple) microRNA 169h
    3. Aquilegia coerulea aqc-miR169b
    4. Arabidopsis lyrata aly-miR169l-5p
    5. Arabidopsis thaliana ath-miR169i
    6. Brachypodium distachyon (stiff brome) bdi-miR169e-5p
    7. Camelina sativa cas-miR169g-5p
    8. Cucumis melo (muskmelon) cme-miR169e
    9. Gossypium herbaceum ghb-miR169a
    10. Gossypium hirsutum ghr-miR169a
    11. Linum usitatissimum lus-miR169k
    12. Malus domestica (apple) mdm-miR169k
    13. Manihot esculenta mes-miR169o
    14. Musa AAB Group miR169
    15. Oryza sativa osa-miR169m
    16. Pachycladon fastigiatum Pfa-miR169h
    17. Populus tomentosa Pto-miR169m
    18. Populus trichocarpa ptc-miR169m
    19. Solanum lycopersicum (tomato) sly-miR169b
    20. Sorghum bicolor (sorghum) sbi-miR169g
    21. Theobroma cacao (cacao) tcc-miR169h
    22. Zea mays zma-miR169k-5p