v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theobroma cacao (cacao) tcc-miR169j URS00004D7772_3641

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCCAAGGAUGACUUGCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aegilops tauschii ata-miR169i-5p
  2. Ananas comosus microRNA 169h
  3. Aquilegia coerulea aqc-miR169b
  4. Arabidopsis lyrata aly-miR169h-5p
  5. Arabidopsis thaliana (thale cress) ath-miR169m
  6. Brachypodium distachyon (stiff brome) bdi-miR169e-5p
  7. Camelina sativa (false flax) cas-miR169e-5p
  8. Cucumis melo (muskmelon) cme-miR169e
  9. Gossypium herbaceum ghb-miR169a
  10. Gossypium hirsutum (cotton) ghr-miR169a
  11. Linum usitatissimum lus-miR169c
  12. Malus domestica mdm-miR169m
  13. Manihot esculenta mes-miR169p
  14. Musa AAB Group miR169
  15. Oryza sativa Japonica Group microRNA osa-miR169h
  16. Oryza sativa osa-miR169j
  17. Pachycladon fastigiatum Pfa-miR169h
  18. Populus tomentosa Pto-miR169m
  19. Populus trichocarpa ptc-miR169m
  20. Solanum lycopersicum (tomato) sly-miR169b
  21. Sorghum bicolor (sorghum) sbi-miR169f
  22. Zea mays zma-miR169j-5p