Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gossypium herbaceum ghb-miR169a URS00004D7772_34274

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCCAAGGAUGACUUGCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aegilops tauschii ata-miR169i-5p
  2. Ananas comosus microRNA 169h
  3. Aquilegia coerulea aqc-miR169b
  4. Arabidopsis lyrata aly-miR169h-5p
  5. Arabidopsis thaliana (thale cress) ath-miR169m
  6. Brachypodium distachyon (stiff brome) bdi-miR169e-5p
  7. Camelina sativa (false flax) cas-miR169e-5p
  8. Cucumis melo (muskmelon) cme-miR169e
  9. Gossypium hirsutum (cotton) ghr-miR169a
  10. Linum usitatissimum lus-miR169c
  11. Malus domestica mdm-miR169m
  12. Manihot esculenta mes-miR169p
  13. Musa AAB Group miR169
  14. Oryza sativa Japonica Group microRNA osa-miR169h
  15. Oryza sativa osa-miR169j
  16. Pachycladon fastigiatum Pfa-miR169h
  17. Populus tomentosa Pto-miR169m
  18. Populus trichocarpa ptc-miR169m
  19. Solanum lycopersicum (tomato) sly-miR169b
  20. Sorghum bicolor (sorghum) sbi-miR169f
  21. Theobroma cacao (cacao) tcc-miR169j
  22. Zea mays zma-miR169j-5p