Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) Dan-Mir-10-P1_3p* (star (passenger)) URS00004D4199_9361

  • 23 nucleotides
  • 1 database (MirGeneDB)
  • Found in 12 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAUUCGGUUCUAGAGAGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bombyx mori bmo-miR-10-3p
  2. Cochliomyia hominivorax mature cho-miR-10-3p
  3. Cochliomyia macellaria mature cma-miR-10-3p
  4. Culex quinquefasciatus (southern house mosquito) cqu-miR-10-3p
  5. Dinoponera quadriceps dqu-miR-10-3p
  6. Drosophila melanogaster dme-miR-10-3p
  7. Drosophila mojavensis Dmo-Mir-10-P1_3p (mature (co-guide))
  8. Drosophila simulans Dsi-Mir-10-P1_3p (mature (co-guide))
  9. Drosophila virilis dvi-miR-10-3p
  10. Drosophila yakuba Dya-Mir-10-P1_3p (mature (co-guide))
  11. Manduca sexta mse-miR-10a
  12. Tribolium castaneum tca-miR-10-3p