Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-130a-3p URS00004D1582_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-130a: gga-mir-130a is a microRNA that has been found to be downregulated in an MDV-infected spleen, and it inhibits the proliferation and migration of MSB-1 cells by targeting homeobox A3 (HOXA3) and myogenic differentiation (MyoD) family inhibitor domain containing (MDFIC) [PMC6862082]. It has also been shown to inhibit MSB-1 cell proliferation and migration [PMC7587795]. The expression of gga-mir-130a, along with several other miRNAs, has been detected in various studies [PMC3406056]. Furthermore, gga-mir-130a, along with other miRNAs such as gga-miR-221 and gga-miR-222, has been shown to influence the function of mature DCs [PMC4735322]. Quantitative real-time PCR analysis confirmed the expression levels of gga-mir-130a in different studies [PMC4735322]. Functional studies have revealed that gga-mir-130a inhibits MDV-transformed lymphoid cells proliferation and migration by targeting HoxA3 [PMC6663980]. In a study on fat broiler lines, gga-mir-130a was found to be lowly expressed [PMC4326283]. Both gga-mir-130a and gga-miR-103 have been shown to inhibit the proliferation of MSB1 cells [PMC5484716]. Specifically, gga-mir-130a targets HOXA3 and MDFIC while gga-miR103 targets CCNE1 and TFDP2 [PMC5484716].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUAUUAAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications