v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-51488578 URS00004D1582_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 1 database (PirBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CAGUGCAAUAUUAAAAGGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Alligator mississippiensis (American alligator) ami-miR-130b-3p
    2. Anolis carolinensis aca-miR-130c
    3. Callorhinchus milii Cmi-Mir-130-P1b_3p (mature (guide))
    4. Chrysemys picta bellii Cpi-Mir-130-P1a_3p (mature (guide))
    5. Chrysemys picta (Painted turtle) cpi-miR-130c-3p
    6. Columba livia (rock pigeon) cli-miR-130c-3p
    7. Cyprinus carpio ccr-miR-130c
    8. Danio rerio dre-miR-130c-3p
    9. Gadus morhua gmo-miR-130a-3p
    10. Gallus gallus gga-miR-130a-3p
    11. Gekko japonicus Gja-Mir-130-P1a_3p (mature (guide))
    12. Latimeria chalumnae Lch-Mir-130-P1a_3p (mature (guide))
    13. Lepisosteus oculatus Loc-Mir-130-P1a_3p (mature (co-guide))
    14. Microcaecilia unicolor Mun-Mir-130-P1a_3p (mature (guide))
    15. Monopterus albus Mal-Mir-130-P1a2_3p (mature (guide))
    16. Ophiophagus hannah (king cobra) oha-miR-130a-3p
    17. Scyliorhinus torazame (cloudy catshark) Sto-Mir-130-P1b_3p (mature (guide))
    18. Sphenodon punctatus (tuatara) Spt-Mir-130-P1a_3p (mature (guide))
    19. Taeniopygia guttata tgu-miR-130a-3p
    20. Takifugu rubripes fru-miR-130
    21. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-130
    22. Tor tambroides miR-130c-3p
    23. Xenopus laevis (African clawed frog) xla-miR-130c-3p
    24. Xenopus tropicalis (tropical clawed frog) xtr-miR-130c