Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xtr-Mir-29-P2b_3p (mature (guide)) URS00004D1411_8364

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 19 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Danio rerio (zebrafish) dre-miR-29b
  2. Eptatretus burgeri Ebu-Mir-29-P1f_3p (mature (guide))
  3. Gadus morhua (Atlantic cod) gmo-miR-29b-3p
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29b
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-29b-3p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72546
  7. Oreochromis niloticus (Nile tilapia) oni-miR-29b
  8. Ornithorhynchus anatinus (platypus) oan-miR-29b-3p
  9. Oryzias latipes ola-miR-29b
  10. Ovis aries oar-miR-29b
  11. Petromyzon marinus pma-miR-29c
  12. Ptychodera flava Pfl-Mir-29-P1_3p (mature (guide))
  13. Pundamilia nyererei pny-miR-29b
  14. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62878
  15. Saccoglossus kowalevskii sko-miR-29b-3p
  16. Scyliorhinus torazame Sto-Mir-29-P1b_3p (mature (guide))
  17. Takifugu rubripes (torafugu) fru-miR-29b
  18. Tetraodon nigroviridis tni-miR-29b
  19. Tor tambroides (Thai mahseer) miR-29b